In Utero and Lactational Exposure to 2,3,7,8-Tetrachlorodibenzo-p-dioxin
Alters Postnatal Development of Seminal Vesicle Epithelium

J. T. Hamm et al / Toxicological Sciences 54, 424-430 1apr2000

 

J. T. Hamm*,†,1, B. R. Sparrow, D. Wolf and L. S. Birnbaum

* Curriculum in Toxicology, University of North Carolina, Chapel Hill, North Carolina 27599; National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, North Carolina 27711; and National Research Council, U.S. Environmental Protection Agency, Research Triangle Park, North Carolina 27711

Received September 13, 1999; accepted December 3, 1999

ABSTRACT

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) has been shown to alter male reproductive development of laboratory animals through in utero and lactational exposure. As a result of exposure, the accessory glands of the male reproductive tract, including the seminal vesicle, are decreased in size as determined by total weight of the tissue. Analysis of seminal vesicle weights over time suggests that the changes may be transient. Administration of 1.0 µg/kg TCDD during gestation caused a significant decrease in seminal vesicle weights of offspring 8–11 months of age. We examined the effects of TCDD on seminal vesicles from rats exposed in utero and lactationally. Pregnant Long Evans rats were gavaged on gestation day 15 with 1.0 µg/kg TCDD in corn oil. Male pups were euthanized and necropsied on postnatal days (PND) 15, 25, 32, 49, 63, and 120. Seminal vesicles were weighed and then fixed in 10% neutral buffered formalin and processed for microscopic examination. Seminal vesicle weights were not significantly decreased until PND 32. Androgen receptor mRNA expression in PND 25 seminal vesicles was not different from control. In the present study, TCDD exposure decreased seminal vesicle epithelial branching and differentiation. Control epithelial cells had tall columnar morphology with relatively abundant cytoplasm, whereas TCDD-treated cells had rounded nuclei and less cytoplasm. In addition, immunolocalization of proliferating nuclear antigen was confined to undifferentiated basal epithelial cells of controls but was found in both basal and luminal cells of the treated seminal vesicle. Results indicate that the TCDD-induced impaired growth of the rat seminal vesicles is associated with a dramatic decrease in the development of the epithelium.

Key Words: TCDD; epithelial differentiation; seminal vesicles.

INTRODUCTION

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is the most toxic member of a class of persistent compounds, the polyhalogenated aromatic hydrocarbons (Safe, 1986). As a result of combustion and chlorine bleaching processes, TCDD is found as an environmental contaminant and bioaccumulates through the food chain, increasing the possibility of toxic effects. Exposures to laboratory animals and reports of human exposure after industrial accidents have shown that TCDD can cause a variety of effects including chloracne, a wasting syndrome, induction of xenobiotic-metabolizing enzymes, and adverse reproductive development (for a review see Birnbaum, 1994a, and Pohjanvirta and Tuomisto, 1994).

Exposure to TCDD during gestation has been shown to perturb the development of the male sex accessory glands in the rat (Gray et al., 1995; Mably et al., 1992). Roman et al. (1998) reported that in utero and lactational exposure to TCDD altered budding of the fetal prostate as well as postnatal epithelial differentiation and smooth muscle thickness. Observations made on tissue weights demonstrate an apparent alteration in the growth of the seminal vesicles from treated pups as evidenced by decreased weight of the tissue in PND 32 rats (Roman et al., 1995). This point of development corresponds to peak androgen levels within the seminal vesicles (Roman et al., 1995) and to a period of rapid proliferation and differentiation within the seminal vesicle epithelium (Fawell and Higgins, 1986).

The objectives of the present study were to establish the time course for TCDD-induced changes in seminal vesicle weights and to define associated microscopic alterations in the Long Evans rat. These data will help to elucidate the mechanism of TCDD-induced effects in the developing seminal vesicle.

MATERIALS AND METHODS

Chemicals.
TCDD (> 98% purity) in acetone (1 mg/10 ml) was obtained from Radian Corp. (Austin, TX). For the preparation of dosing solution, a volume of stock TCDD was added to corn oil and the acetone removed by evaporation using a Savant SpeedVac (Savant Instruments Inc., Farmingdale, NY). Following evaporation, additional corn oil was added to achieve the desired TCDD concentration. All other chemicals were from commercial sources and were of the highest purity available.

Animals.
Time-pregnant Long Evans rats [gestational day (GD) 9; (day after mating = GD 0)] were obtained from Charles River Breeding Laboratories (Raleigh, NC). Females were housed in plastic cages containing heat-treated pine shavings (Beta Chips, North Eastern Products Inc., Warrensburg, NY) and given food (Purina 5001 Rodent Chow, Ralston Purina Co., St. Louis, MO) and water ad libitum.

Dosing.
Two groups of 14 pregnant dams were treated by oral gavage on GD 15 with 1.0 µg/kg TCDD in corn oil or corn oil only for controls in a dosing volume of 5 ml/kg. Litters were culled to five males and three females on postnatal day (PND) 4. At weaning (PND 25), animals were housed as above in unisexual groups of two to three rats per cage.

Tissue weight analysis.
Male pups (n = 9–10, with 1 per litter per time point), were euthanized and necropsied on PND 15, 25, 32, 49, 63, or 120, and body and organ weights recorded. For seminal vesicle weights, the paired organ was clamped at the base and excised, the clamp was subsequently removed, and the fluid contents expressed into a pretared weigh boat. The weight of the remaining tissue, paired seminal vesicles, and attached coagulating glands, was determined and referred to as seminal vesicle tissue weight. Following weighing, seminal vesicles were fixed in 10% neutral-buffered formalin on PND 32.

Histologic analysis.
Formalin-fixed seminal vesicles from PND 32 animals were processed by routine methods for paraffin, sectioned at 5 µM, stained with hematoxylin and eosin, and examined microscopically. Additional sections were stained with trichrome stain to identify collagen. Finally, proliferating cell nuclear antigen (PCNA) was immunolocalized using anti-PCNA antibodies, and sections were counterstained with hematoxylin and examined microscopically. PCNA immunostaining was produced according to the manufacturer instructions (Santa Cruz Biotechnology, Santa Cruz, CA).

Competitive RT-PCR for determination of seminal vesicle androgen receptor mRNA expression.
Seminal vesicles (n = 4) were removed from PND 25 animals, snap frozen, and stored at –80°C. Individual tissues were removed from the freezer and homogenized in Trizol reagent (GibcoBRL, Grand Island, NY). RNA was precipitated from the aqueous fraction and re-extracted with acid phenol:chloroform. The aqueous layer was removed, and RNA was precipitated and resuspended in DEPC-treated water. Samples were quantified and purity was checked using A260/280 ratios.

Construction of internal competitor RNA.
Total RNA isolated from adult Long Evans rat testis was used to generate cDNA as outlined in the random hexamer protocol from a Life Technologies SuperScriptTM Preamplification System for a First Stand cDNA Synthesis kit. A 412 base-pair fragment of the androgen receptor message was amplified by PCR from the cDNA with primers ANDRCP5-1 (GAGAACTACTCCGGACCTTA) and ANDRCPR3-1 (CAATGTGTGATACAGTCATC). These primers were designed from the rat epididymal androgen receptor sequence submitted to Genbank by Tan et al. (1988). A 165 base-pair deletion of the PCR product was constructed using restriction endonuclease and T4 ligation techniques. PCR products were digested with SacI restriction endonuclease followed by electrophoretic separation and purification of the 5' and 3' digestion fragments from a low-melt agarose gel. The 5' and 3' fragments were ligated with T4 ligase and the resultant 247 base-pair fragment inserted into a pCR-ScriptTM Amp SK(+) cloning vector (Stratagene, La Jolla, CA). The recombinant vector, labeled pCR-AR412165, was used to transform Epicurian ColiTM XL1-Blue' Kan supercompetent cells (Stratagene, La Jolla, CA). The transformed cells were plated on LB-ampicillin-5-bromo-4-chloro-3-indoyl-ß-D-galactopyranoside (X-gal) and isopropyl-1-thio-ß-D-galactopyranoside (IPTG) agarose plates. Selected white colonies were screened for recombinant plasmids and midi-plasmid preps performed with a Qiagen (Chatsworth, CA) Qiafilter Plasmid Midi Kit. Recombinant plasmids containing the truncated androgen receptor sequence were linearized with PVU II restriction endonuclease, thereby enabling transcription of the androgen receptor sequence using an Epicentre Technologies (Madison, WI) AmpliScribe™ T7 transcription kit. Transcription reactions were extracted twice with acid phenol:chloroform followed by a single extraction with chloroform, then precipitated with 1/10 volume 8-M LiCl (Sigma, St. Louis, MO) and 2.5 volumes absolute ethanol. The precipitated RNA was suspended in Ambion (Austin, TX) RNA storage solution; concentration and purity were estimated spectrophotometrically. A portion of the internal competitor RNA was diluted in Ambion RNA storage solution to 1 x 109 molecules/2.5 µl and stored as single-use aliquots at –80°C.

RT-PCR.
Total RNA (100 ng) from seminal vesicle was combined with specified amounts of internal standard androgen receptor RNA diluted in nuclease free water (Promega, Madison, WI) from the 1 x 109 molecules/2.5 µl single-use aliquots, and subjected to reverse transcription (RT) reactions as detailed in an Ambion (Austin, TX) RETROscriptTM first strand synthesis kit for RT-PCR. A fraction of the RT reaction (5 µl) was PCR amplified in 50-µl PCR reaction mixes following protocols by Life Technologies for Platinum Taq polymerase and using primers ANDRCP5-1 and ANDRCPR3-1. PCR cycling parameters were as follows: denature 94°C, 4:00; denature 94°C, 0:45; anneal 57°C, 1:20; extend 72°C, 2:30, for a total of 32 cycles; extend 72°C, 5:00. A fraction of the PCR reaction (5 µl) was subjected to electrophoretic separation in 3% FMC (Rockland, ME) NuSeive® 3:1 agarose gels containing FMC (Rockland, ME) Gel Star® nucleic acid stain. Electrophoresed PCR products were visualized over UV light; band intensity was quantified densitometrically using an Alpha Inotech (San Leandro, CA) CCD video camera and image analysis software. The log ratio of androgen receptor RNA internal competitor to sample androgen receptor mRNA versus the log of androgen receptor RNA internal competitor were plotted to determine amplification efficiencies and estimate molecules of experimental androgen receptor mRNA per 100 ng total RNA.

Statistics.
Using StatView 4.5 (Abacus Concepts, Inc., Berkeley, CA), data was evaluated for statistical significance using one-way analyses of variance (ANOVA) followed by Fisher's PLSD test as a post hoc test. A p < 0.05 defined statistically significant differences.

RESULTS

Organ Weights
Seminal vesicles from control rats showed little weight change from PND 15 to PND 25. However, the gland began to grow more rapidly between PND 25 and PND 32 (Table 1). Similarly, no difference between control and treated seminal vesicle weights was recorded for PND 15 or PND 25. However, by PND 32, control seminal vesicles were significantly larger (Fig. 1). By PND 49, the gland had undergone extensive growth and it was possible to begin collecting fluid secretions. Control glands produced significantly more fluid; however, at later time points, TCDD exposure did not affect fluid production. In contrast, the weight of the seminal vesicles measured without fluid content remained significantly decreased at PND 120.

TABLE 1 Effect of in Utero and Lactational TCDD Exposure on Body Weight and Seminal Vesicle Weight of Male Rat Offspring 15 to 120 Days of Age

                 Seminal vesicle  Seminal vesicle    Total SV
  PND   Body (g)   tissue (mg)       fluid (mg)       (mg)
Control
15	 31±1        NA               NA              10±1
25       75±2        NA               NA              16±1
32      123±3        NA               NA              60±3
49      279±6      324±18           142±13           465±27
63      346±7      531±22           345±17           875±34
120     678±17     992±60           651±35          1642±79
TCDD treated
15       31±1        NA               NA              10±1
25       69±3        NA               NA              17±1
32      117±3        NA               NA              37±3 b,c
49      257±11 a   224±24 b,c        81±19 b,c       304±28 b,c
63      316±7  a   399±13 b,c       313±18           712±21 b,c
120     563±14 a   744±5 b,c        564±37          1309±63 a
  Note. Values are means ± SE (n = 9–10 males per time point, with 1 male
per litter). NA, not applicable. Seminal vesicle tissue represents the weight of
the paired seminal vesicles and the attached coagulating glands following
expression of the fluid contents. Total SV represents the combined weight of
the seminal vesicles and their fluid contents.
  a Significant difference in the body weight of exposed offspring.
  b Significant t difference (p < 0.05) from control in the tissue weight.
  c Significant t difference (p < 0.05) from control in the tissue weight to body
weight ratio.

 

Seminal Vesicle Histology

Because PND 32 was the earliest point at which seminal vesicles from treated pups had a significantly decreased weight, these tissues were examined for microscopic alterations. Histologic examination of control rat seminal vesicles revealed extensive branching of the epithelium of the gland. In comparison, the seminal vesicle from TCDD-treated rats had substantially less epithelium with little branching (Fig. 2). Although it was not possible to collect fluid secretions at PND 32, protein is visible in the lumen of the seminal vesicle (Fig. 2). At higher magnification, the seminal vesicle from control rats is characterized by tall columnar epithelial cells flattened along their lumenal surface. In addition, seminal vesicle epithelial cells from control rats contain abundant cytoplasmic material. The seminal vesicle epithelium from TCDD-exposed pups is composed of short columnar cells containing relatively limited cytoplasm (Fig. 3).

Proliferating cells were identified by proliferating cell nuclear antigen (PCNA) immunoreactivity. Most PCNA reactivity in seminal vesicles from control rats was found in the undifferentiated epithelial cells at the basal portions of the glands, with little staining of the differentiated tall columnar luminal epithelial cells (Fig. 4). In contrast, the undifferentiated epithelial cells bordering the lumen from TCDD-exposed rats are actively undergoing proliferation. A subepithelial layer of collagen was markedly increased in thickness in seminal vesicles from TCDD-streated rats (Fig. 5).

Androgen Receptor mRNA Expression

Measurement of seminal vesicle weights demonstrated decreased growth of TCDD-exposed tissue between PND 25 and PND 32. From previous reports, levels of androgen were shown to rapidly increase within the seminal vesicles during this same time period (Roman et al., 1995). Therefore, PND 25 seminal vesicles were isolated to look for differences in androgen receptor mRNA expression that might account for the decreased growth by PND 32. However, androgen receptor mRNA expression was not different between treated and control rats at PND 25. Quantification of expression revealed 1.2 × 106 molecules of androgen receptor mRNA per 100 µg total RNA (Figs. 6A and 6B). 

FIG. 1. Whole-mount image of control (left) and TCDD-exposed seminal vesicles at PND32. Note the decreased size of the exposed tissue. 

FIG. 1. Whole-mount image of control (left) and TCDD-exposed seminal vesicles at PND32. Note the decreased size of the exposed tissue.

 

DISCUSSION

Analysis of seminal vesicle weights demonstrated that beginning between PND 25 and PND 32, TCDD exposure decreased seminal vesicle growth in Long Evans rats. The time course for the observed changes in weight was similar to that reported in the Holtzman rat (Roman et al., 1995). In addition, there was a TCDD-induced decrease in fluid production that may also have contributed to the decreased organ weight. The seminal vesicle epithelium of control animals exhibited extensive branching by PND 32. In contrast, the epithelium from treated animals had fewer and shortened epithelial branches. At higher magnification, control epithelium was characterized by tightly packed tall columnar cells, whereas treated seminal vesicles showed a lower degree of evagination and the epithelium had predominately smaller cells with a lower cytoplasm to nuclear relative volume.

FIGS. 2, 3, 4, and 5. Seminal vesicles from control (A) and TCDD-exposed (B) rats. In Figure 2, first row, control rats have extensive branching of the seminal vesicle gland. The epithelium from the exposed pup has markedly less branching. In Figure 3, second row, lumenal epithelial cells in the control tissue are columnar, with abundant cytoplasm along the lumenal surface. In contrast, the epithelium from TCDD-exposed offspring consists of rounded nuclei with limited cytoplasm along the lumenal surface. The lumen (L) is denoted in Figure 3A. Figure 4 (third row) demonstrates immunoreactivity to PCNA. Control rats have actively proliferating epithelium along the basal portions of the gland (arrows) and less immunoreactivity closer to the lumen (arrowheads). In contrast, the lumenal and basal epithelial cells from TCDD-exposed rats are actively undergoing proliferation; PCNA immunostaining, hematoxylin, bar = 75 µM. In Figure 5, fourth row, there is markedly increased subepithelial collagen in the TCDD-treated animals (arrows); trichrome, bar = 75 µM.

Figure 2

 

Figure 3

 

Figure 4

 

Figure 5

 

The postnatal period examined in our study corresponds to a period of rapid proliferation and differentiation within the rat seminal vesicle epithelium (Fawell and Higgins, 1986). The presence of numerous cells in the seminal vesicles from control rats with substantial immunoreactivity for proliferating cell nuclear antigen (PCNA) confirmed this. Localization of PCNA immunoreactivity in seminal vesicles from control animals was primarily in undifferentiated basal cells but not in the terminally differentiated luminal epithelium. In contrast, in the undifferentiated TCDD-exposed seminal vesicles, PCNA immunoreactivity was at both the basal and luminal surfaces of poorly branched glands, indicative of the delayed development of the TCDD-treated organ. The present study is consistent with the altered epithelial proliferation following in utero and lactational exposure to TCDD reported for other organs. Roman et al. (1998) demonstrated that TCDD alters prostatic epithelial budding. Similarly, Furth et al. (1999) reported TCDD-induced decreases in the epithelial branching of the mammary glands of female rat pups. TCDD has also been reported to alter epithelial development of mouse ureters (Abbott et al., 1987) and palate, both in vivo (Abbott and Birnbaum, 1989) and in vitro (Abbott et al., 1989; Abbott and Birnbaum, 1991).

In the present study, TCDD also caused increased subepithelial collagen. This observation was analogous to what was reported by Chang et al. (1999) in the rat prostate after estradiol exposure during the early postnatal period altered the expression of laminin and collagen IV protein in the basement membrane and caused a thickened layer of fibroblasts. These authors hypothesized that this layer of cells caused the lack of responsiveness of the prostate epithelium to androgens during early adulthood (Chang et al., 1999). In the seminal vesicles from TCDD-treated rats, it is unclear whether the increase in collagen is due to altered expression or simply a lack of distribution of the collagen due to the inhibition of epithelial branching. However, TCDD has been reported to decrease the expression of laminin and fibronectin proteins in fetal mouse kidney following gestational exposure (Abbott et al., 1987). It may be that TCDD-induced changes in extracellular matrix inhibited epithelial development in the seminal vesicles.

Branching of the seminal vesicles, as well as the maintenance of the organ, are dependent upon androgens (Higgins et al., 1976; Tsuji et al., 1991), and TCDD-induced changes in androgen status could alter reproductive development. However, although Roman et al. (1995) demonstrated that androgen levels peak in seminal vesicles at PND 32, in utero and lactational exposure to 1.0 mg/kg TCDD did not alter androgen mRNA levels. In addition, others have shown that this exposure regime does not alter serum levels of testosterone during this period of development (Gray et al., 1997; Roman et al., 1995). Furthermore, Gray et al. (1995) reported that TCDD did not alter androgen receptor levels in the epididymis of offspring 8–11 months of age. In our study we found that androgen receptor mRNA was not changed by TCDD treatment in PND 25 seminal vesicles (Fig. 6B). The lack of effect on either circulating androgen levels or receptor expression is in agreement with the observation that androgen receptor expression is highly regulated by circulating levels of androgens (Bentvelsen et al., 1995). These findings demonstrate that the decreased growth in TCDD-treated tissue does not result from decreased androgens or receptor content.

Growth factors have been shown to be important modulators of the androgen-dependent development of the seminal vesicles (Alarid et al., 1994; Tanji et al., 1994). In addition, growth factors and their signaling pathways have been shown to affect transcriptional activity of the androgen receptor (Culig et al., 1995; Reinikainen et al., 1996), estrogen receptor (Ignar-Trowbridge, 1995), and glucocorticoid receptor (Krstic, 1997). Numerous studies have shown that TCDD is capable of altering the expression of numerous growth factors in a variety of tissues (for a review see Birnbaum, 1995). Given the importance of growth factors in the development of the seminal vesicles and the ability of TCDD to alter the expression of multiple growth factors in a variety of systems, it is plausible that TCDD-induced changes in growth factor expression disrupt seminal vesicle development.

TCDD-induced changes are mediated through the AhR (Birnbaum, 1994b). Hushka et al. (1998) reported that the AhR agonist 2,3,7,8-tetrachlorodibenzofuran decreases mammary gland proliferation in vitro and analysis of AhR 2/2 mice also reveals decreased mammary gland development. In a similar fashion to the seminal vesicles, the mammary gland appears to exhibit altered epithelial development following in utero and lactational TCDD exposure (unpublished results from this laboratory; Furth et al., 1999)

TCDD is known to alter the expression of AhR in male reproductive tract tissues (Sommer et al., 1999). Bryant et al. (1997) reported that gestational exposure to TCDD decreased the expression of ARNT in the mouse kidney tubule. In addition to possible changes in the level of expression, exposure leads to the formation of AhR-ARNT complexes and should alter the endogenous protein–protein interactions of ARNT. CBP/p300, a transcriptional coregulator, has been shown to be a coactivator of ARNT (Kobayashi et al., 1997) and the androgen receptor (Fronsdal et al., 1998). Transcriptional coregulators modify levels of transcription between diverse pathways, and the interplay between pathways is crucial in development (Mannervik et al., 1999). Furthermore, Jana et al. (1999) demonstrated reciprocal inhibition of transcriptional pathways between TCDD and testosterone in prostate cancer cells.

In conclusion, in utero and lactational exposure to 1.0 mg/kg TCDD inhibits the proliferation and differentiation of the seminal vesicle epithelium. However, Mably et al. (1992) reported that with added development, effects on the seminal vesicle weight decreased. We see a similar trend, although the weight of the seminal vesicle tissue remains significantly lower at PND 120. It was not determined in the present study if the histologic changes reflect a delay in development or a permanent alteration. Therefore, future efforts will examine the seminal vesicle epithelium throughout development and maturation to see if the epithelial changes persist and to identify alterations that may precede the decreases in seminal vesicle weight. These observations should help in interpreting the mechanism of TCDD-induced alterations within the epithelium.

FIG. 6. (A) Expression of androgen receptor mRNA in PND32 seminal vesicles. The upper band is amplified seminal vesicle mRNA, whereas the lower band is the competitor. Lane 1 = 156,250 molecules of internal competitor. Lane 2 = 312,500 molecules of internal competitor. Lane 3 = 1,250,000 molecules of internal competitor. Lane 4 = 2,500,000 molecules of internal competitor. Lane 5 = 5,000,000 molecules of internal competitor. RNA was amplified by reverse transcription PCR using primers and conditions detailed in the Materials and Methods section. (B) Mean level (n = 4±SD) of AR mRNA expression in PND32 seminal vesicles. No significant difference was observed between control and treated tissue.

 

ACKNOWLEDGMENTS

The authors thank Vicki Richardson, David Ross, and Dr. Brian Slezak for their help with necropsies. We would also like to thank Keith Tarpley for his help in creating the figures. Financial support for this work was provided by the

U.S. Environmental Protection Agency Cooperative Training Agreement (# CT902908) with the University of North Carolina, Chapel Hill, NC 27599 – 7270. Additional funding was supplied by the National Research Council (# CR824072). 

 

REFERENCES

Abbott, B. D., and Birnbaum, L. S. (1989). TCDD alters medial epithelial cell differentiation during palatogenesis. Toxicol. Appl. Pharmacol. 99, 276 –

286. Abbott, B. D., and Birnbaum, L. S. (1991). TCDD exposure of human embryonic palatal shelves in organ culture alters the differentiation of medial epithelial cells. Teratology 43, 119–132.

Abbott, B. D., Birnbaum, L. S., and Pratt, R. M. (1987). TCDD-induced hyperplasia of the ureteral epithelium produces hydronephrosis in murine fetuses. Teratology 35, 329–334.

Abbott, B. D., Diliberto, J. J., and Birnbaum, L. S. (1989). 2,3,7,8-Tetrachlorodibenzo-p-dioxin alters embryonic palatal medial epithelial cell differentiation in vitro. Toxicol. Appl. Pharmacol. 100, 119–131.

Alarid, E. T., Rubin, J. S., Young, P., Chedid, M., Ron, D., Aaronson, S. A., and Cunha, G. R. (1994). Keratinocyte growth factor functions in epithelial induction during seminal vesicle development. Proc. Natl. Acad. Sci.USA 91, 1074–1078.

Bentvelsen, F. M., Brinkmann, A. O., van der Schoot, P., van der Linden, J. E., van der Kwast, T. H., Boersma, W. J., Schroder, F. H., and Nijman, J. M. (1995). Developmental pattern and regulation by androgens of androgen receptor expression in the urogenital tract of the rat. Mol. Cell. Endocrinol. 113, 245–253.

Birnbaum, L. S. (1994a). Endocrine effects of prenatal exposure to PCBs, dioxins, and other xenobiotics: implications for policy and future research. Environ. Health Perspect. 102, 676 –679.

Birnbaum, L. S. (1994b). The mechanism of dioxin toxicity: relationship to risk assessment. Environ. Health Perspect. 102(suppl. 9), 157–167.

Birnbaum, L. S. (1995). Developmental effects of dioxins and related endocrine disrupting chemicals. Toxicol. Lett. 103(suppl 7), 743–750.

Bryant, P. L., Clark, G. C., Probst, M. R., and Abbott, B. D. (1997). Effects of TCDD on Ah receptor, ARNT, EGF, and TGF-a expression in embryonic mouse urinary tract. Teratology 55, 326–337.

Chang, W. Y., Wilson, M. J., Birch, L., and Prins, G. S. (1999). Neonatal estrogen stimulates proliferation of periductal fibroblasts and alters the extracellular matrix composition in the rat prostate. Endocrinology 140, 405–415.

Culig, Z., Hobisch, A., Cronauer, M. V., Radmayr, C., Trapman, J., Hittmair, A., Bartsch, G., and Klocker, H. (1995). Androgen receptor activation in prostatic tumor cell lines by insulin-like growth factor-I, keratinocyte growth factor and epidermal growth factor. Eur. Urol. 27(suppl. 2), 45–47.

Fawell, S. E., and Higgins, S. J. (1986). Tissue distribution, developmental profile and hormonal regulation of androgen-responsive secretory proteins of rat seminal vesicles studied by immunocytochemistry. Mol. Cell. Endocrinol. 48, 39 –49.

Fronsdal, K., Engedal, N., Slagsvold, T., and Saatcioglu, F. (1998). CREB binding protein is a coactivator for the androgen receptor and mediates cross-talk with AP-1. J. Biol. Chem. 273, 31853–31859.

Furth, P. A., Lewis, B., Lewis, A., Sommer, R., Peterson, R. E., and Flaws, J. (1999). In utero and lactational TCDD exposure alters estrogen induced mammary gland growth in the rat. Toxicologist 48, 215.

Gray, L. E., Jr., Kelce, W. R., Monosson, E., Ostby, J. S., and Birnbaum, L. S. (1995). Exposure to TCDD during development permanently alters reproductive function in male Long Evans rats and hamsters: reduced ejaculated and epididymal sperm numbers and sex accessory gland weights in offspring with normal androgenic status. Toxicol. Appl. Pharmacol. 131, 108–118.

Gray, L. E., Ostby, J. S., and Kelce, W. R. (1997). A dose-response analysis of the reproductive effects of a single gestational dose of 2,3,7,8-tetrachlorodibenzo-p-dioxin in male Long Evans hooded rat offspring. Toxicol. Appl. Pharmacol. 146, 11–20.

Higgins, S. J., Burchell, J. M., and Mainwaring, W. I. P. (1976). Testosterone control of nucleic acid content and proliferation of epithelium and stroma in rat seminal vesicles. Biochem J. 160, 43–48.

Hushka, L. J., Williams, J. S., and Greenlee, W. F. (1998). Characterization of 2,3,7,8-tetrachlorodibenzofuran-dependent suppression and Ah receptor pathway gene expression in the developing mouse mammary gland. Toxicol. Appl. Pharmacol. 152, 200–210.

Ignar-Trowbridge, D. M., Pimentel M., Teng C. T., Korach K. S., and

McLachlan, J. A. (1995). Cross talk between peptide growth factor and estrogen receptor signaling systems. Environ. Health Perspect. 103(suppl 7), 35–38.

Jana, N. R., Sarkar, S., Ishizuka, M., Yonemoto, J., Tohyama, C., and Sone, H. (1999). Cross-talk between 2,3,7,8-tetrachlorodibenzo-p-dioxin and testosterone signal transduction pathways in LNCaP prostate cancer cells. Biochem. Biophys. Res. Commun. 256, 462–468.

Kobayashi, A., Numayama-Tsuruta, K., Sogawa, K., and Fujii-Kuriyama, Y. (1997). CBP/p300 functions as a possible transcriptional coactivator of Ah receptor nuclear translocator (Arnt). J. Biochem. (Tokyo) 122, 703–710.

Krstic, M. D., Rogatsky, I., Yamamoto, K. R., and Garabedian, M. J. (1997). Mitogen-activated and cyclin-dependent protein kinases selectively and differentially modulate transcriptional enhancement by the glucocorticoid receptor. Mol. Cell. Biol. 17, 3947–3954.

Mably, T. A., Moore, R. W., and Peterson, R. E. (1992). In utero and lactational exposure of male rats to 2,3,7,8-tetrachlorodibenzo-p-dioxin. 1. Effects on androgenic status. Toxicol. Appl. Pharmacol. 114, 97–107.

Mannervik, M., Nibu, Y., Zhang, H., and Levine, M. (1999). Transcriptional coregulators in development. Science 284, 606 –609.

Pohjanvirta, R., and Tuomisto, J. (1994). Short-term toxicity of 2,3,7,8tetrachlorodibenzo-p-dioxin in laboratory animals: effects, mechanisms, and animal models. Pharmacol. Rev. 46, 483–549.

Reinikainen, P., Palvimo, J. J., and Janne, O. A. (1996). Effects of mitogens on androgen receptor-mediated transactivation. Endocrinology 137, 4351–4357.

Roman, B. L., Sommer, R. J., Shinomiya, K., and Peterson, R. E. (1995). In utero and lactational exposure of the male rat to 2,3,7,8-tetrachlorodibenzop-dioxin: impaired prostate growth and development without inhibited androgen production. Toxicol. Appl. Pharmacol. 134, 241–250.

Roman, B. L., Timms, B. G., Prins, G. S., and Peterson, R. E. (1998). In utero and lactational exposure of the male rat to 2,3,7,8-tetrachlorodibenzo-pdioxin impairs prostate development. 2. Effects on growth and cytodifferentiation. Toxicol. Appl. Pharmacol. 150, 254–270.

Safe, S. H. (1986). Comparative toxicology and mechanism of action of polychlorinated dibenzo-p-dioxins and dibenzofurans. Annu. Rev. Pharmacol. Toxicol. 26, 371–399.

Sommer, R. J., Sojka, K. M., Pollenz, R. S., Cooke, P. S., and Peterson, R. E. (1999). Ah receptor and ARNT protein and mRNA concentrations in rat prostate: effects of stage of development and 2,3,7,8-tetrachlorodibenzo-pdioxin treatment. Toxicol. Appl. Pharmacol. 155, 177–189.

Tan, J., Joseph, D. R., Quarmby, V. E., Lubahn, D. B., Sar, M., French, F. S., and Wilson, E. M. (1988). The rat androgen receptor: primary structure, autoregulation of its messenger ribonucleic acid, and immunocytochemical localization of the receptor protein. Mol. Endocrinol. 2, 1276–1285.

Tanji, N., Tsuji, M., Terada, N., Takeuchi, M., and Cunha, G. R. (1994). Inhibitory effects of transforming growth factor-beta 1 on androgen-induced development of neonatal mouse seminal vesicles in vitro. Endocrinology 134, 1155–1162.

Tsuji, M., Shima, H. and Cunha, G. R. (1991). Morphogenetic and proliferative effects of testosterone and insulin on the neonatal mouse seminal vesicle in vitro. Endocrinology 129, 2289–2297.

To send us your comments, questions, and suggestions click here
The home page of this website is www.mindfully.org
Please see our Fair Use Notice